rna 5 Search Results


pyrophosphatase rpph  (New England Biolabs)
98
New England Biolabs pyrophosphatase rpph
Pyrophosphatase Rpph, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/RNA+5+Pyrophosphohydrolase/pmc13153714-54-12-14
Average 98 stars, based on 1 article reviews
pyrophosphatase rpph - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
oti1d3  (OriGene)
92
OriGene oti1d3
Oti1d3, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/RNA5-8SN2+Mouse+Monoclonal+Antibody/pm37754761-214-0-2
Average 92 stars, based on 1 article reviews
oti1d3 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier
rna 5  (New England Biolabs)
98
New England Biolabs rna 5
Rna 5, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/RNA+5+Pyrophosphohydrolase/bio_rxiv__2024__12__23__630015-248-14-17
Average 98 stars, based on 1 article reviews
rna 5 - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier
biotin-labeled single-stranded rna (5′ gpppaccccccccc-biotin 3′)  (TriLink)
90
TriLink biotin-labeled single-stranded rna (5′ gpppaccccccccc-biotin 3′)
Biotin Labeled Single Stranded Rna (5′ Gpppaccccccccc Biotin 3′), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/biotin+labeled+single+stranded+rna++5++gpppaccccccccc+biotin+3++/pm34192965-25-2-18
Average 90 stars, based on 1 article reviews
biotin-labeled single-stranded rna (5′ gpppaccccccccc-biotin 3′) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
mini-rna 5′-agccgcgaggggagggauaggguagggcgcggcu-3′  (Samchully Pharm Co Ltd)
90
Samchully Pharm Co Ltd mini-rna 5′-agccgcgaggggagggauaggguagggcgcggcu-3′
Mini Rna 5′ Agccgcgaggggagggauaggguagggcgcggcu 3′, supplied by Samchully Pharm Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/mini+rna+5++agccgcgaggggagggauaggguagggcgcggcu+3+/pmc03198746-94-1-14
Average 90 stars, based on 1 article reviews
mini-rna 5′-agccgcgaggggagggauaggguagggcgcggcu-3′ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
pcat19 small interfering (si)rna  (Shanghai GenePharma)
90
Shanghai GenePharma pcat19 small interfering (si)rna
Pcat19 Small Interfering (Si)rna, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/pcat19+small+interfering++si+rna++5++gauccuuagguucucagaaac+3++/pmc06896364-136-20-31
Average 90 stars, based on 1 article reviews
pcat19 small interfering (si)rna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
rna (5′-ccaaaauuucaag aucagggcuugaaauuuuguaaaauuucaagcccugaucuugaa auuuucca3′  (GenScript corporation)
90
GenScript corporation rna (5′-ccaaaauuucaag aucagggcuugaaauuuuguaaaauuucaagcccugaucuugaa auuuucca3′
Rna (5′ Ccaaaauuucaag Aucagggcuugaaauuuuguaaaauuucaagcccugaucuugaa Auuuucca3′, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/rna++5++ccaaaauuucaag+aucagggcuugaaauuuuguaaaauuucaagcccugaucuugaa+auuuucca3+/pm39407643-259-8-12
Average 90 stars, based on 1 article reviews
rna (5′-ccaaaauuucaag aucagggcuugaaauuuuguaaaauuucaagcccugaucuugaa auuuucca3′ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
synthetic 27-nucleotide rna (5′-gguuggugggagggacugaggccuggu-3′)  (GenScript corporation)
90
GenScript corporation synthetic 27-nucleotide rna (5′-gguuggugggagggacugaggccuggu-3′)
Synthetic 27 Nucleotide Rna (5′ Gguuggugggagggacugaggccuggu 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/galnt3+guide+rna+5%E2%80%99atttctttgcaccg+agatct3/pmc06314137-475-0-19
Average 90 stars, based on 1 article reviews
synthetic 27-nucleotide rna (5′-gguuggugggagggacugaggccuggu-3′) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
galnac-rna 5′-dgdcuauaagugugcaugagaac-galnac3-3′  (Microsynth ag)
90
Microsynth ag galnac-rna 5′-dgdcuauaagugugcaugagaac-galnac3-3′
Galnac Rna 5′ Dgdcuauaagugugcaugagaac Galnac3 3′, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/galnac+rna+5++dgdcuauaagugugcaugagaac+galnac3+3+/pmc09962178-26-5-10
Average 90 stars, based on 1 article reviews
galnac-rna 5′-dgdcuauaagugugcaugagaac-galnac3-3′ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
24/40-mer dna/rna primer/template substrate (dna-5'-atcaccaggagaggggaaagcgga; rna-5'-dy647-cuaauuccgcuuuccccucuccuggugauccuuuccaucc  (biomers.net gmbh)
90
biomers.net gmbh 24/40-mer dna/rna primer/template substrate (dna-5'-atcaccaggagaggggaaagcgga; rna-5'-dy647-cuaauuccgcuuuccccucuccuggugauccuuuccaucc
RNase H activities of the full length PFV PR-RT and RNase H-(Q 591 -N 751 ) . (A) Quantitative RNase H activity assay . Steady state kinetic measurements of the velocity (pmol/s) of the RNase H activities were performed with 1 nM PR-RT (closed circles) and 10 nM RNase H-(Q 591 -N 751 ) (open circles), respectively, using increasing amounts of a fluorescently labeled <t>DNA/RNA</t> hybrid substrate as indicated. For PFV PR-RT the following values were obtained: K M = 5.3 nM (± 0.8), v max = 0.05 pmol/s (± 0.002). The values were obtained by the fit program GraFit using the Michaelis-Menten equation v = v max [S]/(K M + [S]) for the fitting procedure. The curve shows the best fit to the data. Due to its low activity, the kinetic parameters for the RNase H domain could not be determined. (B) Qualitative RNase H assay . The 20/27mer DNA/RNA primer/template substrate is shown on top of the figure. The cleavage sites are indicated by arrows in the sequence on top and at the corresponding band on the gel. The first nucleotide of the RNA hybridized to the 3'-OH nucleotide of the DNA strand is designated -1. 240 nM of the substrate were incubated with 30 nM PFV PR-RT or 20 μM of the RNase H domain for the times indicated on top of the gel. Reaction products were separated on a 15% sequencing gel and visualized by phosphoimaging.
24/40 Mer Dna/Rna Primer/Template Substrate (Dna 5' Atcaccaggagaggggaaagcgga; Rna 5' Dy647 Cuaauuccgcuuuccccucuccuggugauccuuuccaucc, supplied by biomers.net gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/6+carboxy+fluorescein++6+fam+++rna+5++ccgaucgcucuccuggugauccuuucc+6+fam+/pmc03305377-148-4-10
Average 90 stars, based on 1 article reviews
24/40-mer dna/rna primer/template substrate (dna-5'-atcaccaggagaggggaaagcgga; rna-5'-dy647-cuaauuccgcuuuccccucuccuggugauccuuuccaucc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
messenger rna  (5 PRIME)
90
5 PRIME messenger rna
RNase H activities of the full length PFV PR-RT and RNase H-(Q 591 -N 751 ) . (A) Quantitative RNase H activity assay . Steady state kinetic measurements of the velocity (pmol/s) of the RNase H activities were performed with 1 nM PR-RT (closed circles) and 10 nM RNase H-(Q 591 -N 751 ) (open circles), respectively, using increasing amounts of a fluorescently labeled <t>DNA/RNA</t> hybrid substrate as indicated. For PFV PR-RT the following values were obtained: K M = 5.3 nM (± 0.8), v max = 0.05 pmol/s (± 0.002). The values were obtained by the fit program GraFit using the Michaelis-Menten equation v = v max [S]/(K M + [S]) for the fitting procedure. The curve shows the best fit to the data. Due to its low activity, the kinetic parameters for the RNase H domain could not be determined. (B) Qualitative RNase H assay . The 20/27mer DNA/RNA primer/template substrate is shown on top of the figure. The cleavage sites are indicated by arrows in the sequence on top and at the corresponding band on the gel. The first nucleotide of the RNA hybridized to the 3'-OH nucleotide of the DNA strand is designated -1. 240 nM of the substrate were incubated with 30 nM PFV PR-RT or 20 μM of the RNase H domain for the times indicated on top of the gel. Reaction products were separated on a 15% sequencing gel and visualized by phosphoimaging.
Messenger Rna, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/messenger+rna/us12030057-2339-0-9
Average 90 stars, based on 1 article reviews
messenger rna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
radiolabelled capped 11-nucleotide rna (5′-pppgaauacucaag-3′  (ChemGenes corporation)
90
ChemGenes corporation radiolabelled capped 11-nucleotide rna (5′-pppgaauacucaag-3′
RNase H activities of the full length PFV PR-RT and RNase H-(Q 591 -N 751 ) . (A) Quantitative RNase H activity assay . Steady state kinetic measurements of the velocity (pmol/s) of the RNase H activities were performed with 1 nM PR-RT (closed circles) and 10 nM RNase H-(Q 591 -N 751 ) (open circles), respectively, using increasing amounts of a fluorescently labeled <t>DNA/RNA</t> hybrid substrate as indicated. For PFV PR-RT the following values were obtained: K M = 5.3 nM (± 0.8), v max = 0.05 pmol/s (± 0.002). The values were obtained by the fit program GraFit using the Michaelis-Menten equation v = v max [S]/(K M + [S]) for the fitting procedure. The curve shows the best fit to the data. Due to its low activity, the kinetic parameters for the RNase H domain could not be determined. (B) Qualitative RNase H assay . The 20/27mer DNA/RNA primer/template substrate is shown on top of the figure. The cleavage sites are indicated by arrows in the sequence on top and at the corresponding band on the gel. The first nucleotide of the RNA hybridized to the 3'-OH nucleotide of the DNA strand is designated -1. 240 nM of the substrate were incubated with 30 nM PFV PR-RT or 20 μM of the RNase H domain for the times indicated on top of the gel. Reaction products were separated on a 15% sequencing gel and visualized by phosphoimaging.
Radiolabelled Capped 11 Nucleotide Rna (5′ Pppgaauacucaag 3′, supplied by ChemGenes corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rna+5/radiolabelled+capped+11+nucleotide+rna++5++pppgaauacucaag+3+/pmc07263517-148-10-13
Average 90 stars, based on 1 article reviews
radiolabelled capped 11-nucleotide rna (5′-pppgaauacucaag-3′ - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


RNase H activities of the full length PFV PR-RT and RNase H-(Q 591 -N 751 ) . (A) Quantitative RNase H activity assay . Steady state kinetic measurements of the velocity (pmol/s) of the RNase H activities were performed with 1 nM PR-RT (closed circles) and 10 nM RNase H-(Q 591 -N 751 ) (open circles), respectively, using increasing amounts of a fluorescently labeled DNA/RNA hybrid substrate as indicated. For PFV PR-RT the following values were obtained: K M = 5.3 nM (± 0.8), v max = 0.05 pmol/s (± 0.002). The values were obtained by the fit program GraFit using the Michaelis-Menten equation v = v max [S]/(K M + [S]) for the fitting procedure. The curve shows the best fit to the data. Due to its low activity, the kinetic parameters for the RNase H domain could not be determined. (B) Qualitative RNase H assay . The 20/27mer DNA/RNA primer/template substrate is shown on top of the figure. The cleavage sites are indicated by arrows in the sequence on top and at the corresponding band on the gel. The first nucleotide of the RNA hybridized to the 3'-OH nucleotide of the DNA strand is designated -1. 240 nM of the substrate were incubated with 30 nM PFV PR-RT or 20 μM of the RNase H domain for the times indicated on top of the gel. Reaction products were separated on a 15% sequencing gel and visualized by phosphoimaging.

Journal: Retrovirology

Article Title: Insights into the structure and activity of prototype foamy virus RNase H

doi: 10.1186/1742-4690-9-14

Figure Lengend Snippet: RNase H activities of the full length PFV PR-RT and RNase H-(Q 591 -N 751 ) . (A) Quantitative RNase H activity assay . Steady state kinetic measurements of the velocity (pmol/s) of the RNase H activities were performed with 1 nM PR-RT (closed circles) and 10 nM RNase H-(Q 591 -N 751 ) (open circles), respectively, using increasing amounts of a fluorescently labeled DNA/RNA hybrid substrate as indicated. For PFV PR-RT the following values were obtained: K M = 5.3 nM (± 0.8), v max = 0.05 pmol/s (± 0.002). The values were obtained by the fit program GraFit using the Michaelis-Menten equation v = v max [S]/(K M + [S]) for the fitting procedure. The curve shows the best fit to the data. Due to its low activity, the kinetic parameters for the RNase H domain could not be determined. (B) Qualitative RNase H assay . The 20/27mer DNA/RNA primer/template substrate is shown on top of the figure. The cleavage sites are indicated by arrows in the sequence on top and at the corresponding band on the gel. The first nucleotide of the RNA hybridized to the 3'-OH nucleotide of the DNA strand is designated -1. 240 nM of the substrate were incubated with 30 nM PFV PR-RT or 20 μM of the RNase H domain for the times indicated on top of the gel. Reaction products were separated on a 15% sequencing gel and visualized by phosphoimaging.

Article Snippet: For the PR-RT a 24/40-mer DNA/RNA primer/template substrate (DNA-5'-ATCACCAGGAGAGGGGAAAGCGGA; RNA-5'-DY647-CUAAUUCCGCUUUCCCCUCUCCUGGUGAUCCUUUCCAUCC) (biomers.net GmbH, Ulm, Germany) was used as described [ ].

Techniques: Activity Assay, Labeling, Rnase H Assay, Sequencing, Incubation

Determination of K D -values by fluorescence anisotropy measurements . 5 nM fluorescently labeled DNA/RNA primer/template substrate was titrated with PR-RT (closed circles) (A) or RNase H-(Q 591 -N 751 ) (open circles) (B) as indicated. The fit of the curve to the data (equation 1) resulted in a K D -value of 9.1 nM (± 1.7) for the full length PFV PR-RT. The K D -value obtained for RNase H-(Q 591 -N 751 ) is greater than 40 μM.

Journal: Retrovirology

Article Title: Insights into the structure and activity of prototype foamy virus RNase H

doi: 10.1186/1742-4690-9-14

Figure Lengend Snippet: Determination of K D -values by fluorescence anisotropy measurements . 5 nM fluorescently labeled DNA/RNA primer/template substrate was titrated with PR-RT (closed circles) (A) or RNase H-(Q 591 -N 751 ) (open circles) (B) as indicated. The fit of the curve to the data (equation 1) resulted in a K D -value of 9.1 nM (± 1.7) for the full length PFV PR-RT. The K D -value obtained for RNase H-(Q 591 -N 751 ) is greater than 40 μM.

Article Snippet: For the PR-RT a 24/40-mer DNA/RNA primer/template substrate (DNA-5'-ATCACCAGGAGAGGGGAAAGCGGA; RNA-5'-DY647-CUAAUUCCGCUUUCCCCUCUCCUGGUGAUCCUUUCCAUCC) (biomers.net GmbH, Ulm, Germany) was used as described [ ].

Techniques: Fluorescence, Labeling